ID: 1179588473_1179588481

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1179588473 1179588481
Species Human (GRCh38) Human (GRCh38)
Location 21:42389217-42389239 21:42389264-42389286
Sequence CCAAGGGGTGGGGCTGCTGTGCC GGCCCAGGAACCACAGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 651} {0: 1, 1: 1, 2: 5, 3: 34, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!