ID: 1179588477_1179588481

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179588477 1179588481
Species Human (GRCh38) Human (GRCh38)
Location 21:42389240-42389262 21:42389264-42389286
Sequence CCACTTTATCTCGCTATGTGGCC GGCCCAGGAACCACAGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 81} {0: 1, 1: 1, 2: 5, 3: 34, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!