ID: 1179609340_1179609344

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1179609340 1179609344
Species Human (GRCh38) Human (GRCh38)
Location 21:42539759-42539781 21:42539812-42539834
Sequence CCTGTCGGAAGTCAGGGTCAGCT GCTTAGAAATTCCAGCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85} {0: 1, 1: 0, 2: 0, 3: 22, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!