ID: 1179704201_1179704217

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1179704201 1179704217
Species Human (GRCh38) Human (GRCh38)
Location 21:43171944-43171966 21:43171974-43171996
Sequence CCCTGTGAGAGCCCCCGCAGGCT TTCTGCAGTCAGTGGGGCTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 106} {0: 2, 1: 0, 2: 3, 3: 33, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!