ID: 1179706715_1179706730

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1179706715 1179706730
Species Human (GRCh38) Human (GRCh38)
Location 21:43185635-43185657 21:43185672-43185694
Sequence CCCCAAACTTTCAGGGAGGCCTG CCTGGGAGGGATCTGAGGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 8, 3: 60, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!