ID: 1179707992_1179708007

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1179707992 1179708007
Species Human (GRCh38) Human (GRCh38)
Location 21:43193672-43193694 21:43193720-43193742
Sequence CCATCCTCCTGGCCGCCACCACC AGAACTCAGCACCATGGTCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!