ID: 1179722907_1179722913

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1179722907 1179722913
Species Human (GRCh38) Human (GRCh38)
Location 21:43325497-43325519 21:43325515-43325537
Sequence CCTTGCACCACATGTGGCCCTGG CCTGGCCAGGTCCCCACTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!