ID: 1179734247_1179734253

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179734247 1179734253
Species Human (GRCh38) Human (GRCh38)
Location 21:43383194-43383216 21:43383218-43383240
Sequence CCGTTGTTTATCCAGCAACAAGC GTGTGGATAGTGAGGATCCCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 12, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!