ID: 1179747600_1179747616

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1179747600 1179747616
Species Human (GRCh38) Human (GRCh38)
Location 21:43451577-43451599 21:43451607-43451629
Sequence CCTCCAGCCCAGCCCCGAGAGCA CAAGGGAGGCTTGGCGGCTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 45, 4: 431} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!