ID: 1179749741_1179749752

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1179749741 1179749752
Species Human (GRCh38) Human (GRCh38)
Location 21:43461002-43461024 21:43461045-43461067
Sequence CCCAGCCTCCTGGAGGAAGCGGC CCACATCCCTGCTGGAGCAATGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 16, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!