ID: 1179750596_1179750609

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1179750596 1179750609
Species Human (GRCh38) Human (GRCh38)
Location 21:43465067-43465089 21:43465104-43465126
Sequence CCAGGTTTCTTCAACAGATAAAC GTGTGTTGGGGGGGGGTGGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 10, 2: 112, 3: 1118, 4: 11945}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!