ID: 1179764836_1179764850

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1179764836 1179764850
Species Human (GRCh38) Human (GRCh38)
Location 21:43564408-43564430 21:43564459-43564481
Sequence CCATGGCCTTGGGTAGCTCCACC TCCTGGCTGCTTTCATGGGCTGG
Strand - +
Off-target summary {0: 7, 1: 120, 2: 603, 3: 1174, 4: 1697} {0: 350, 1: 579, 2: 976, 3: 1101, 4: 1218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!