ID: 1179764837_1179764850

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1179764837 1179764850
Species Human (GRCh38) Human (GRCh38)
Location 21:43564414-43564436 21:43564459-43564481
Sequence CCTTGGGTAGCTCCACCCCTGTG TCCTGGCTGCTTTCATGGGCTGG
Strand - +
Off-target summary {0: 10, 1: 228, 2: 487, 3: 783, 4: 1083} {0: 350, 1: 579, 2: 976, 3: 1101, 4: 1218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!