ID: 1179764842_1179764850

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179764842 1179764850
Species Human (GRCh38) Human (GRCh38)
Location 21:43564430-43564452 21:43564459-43564481
Sequence CCCTGTGGCTTTGCAAGGTATAG TCCTGGCTGCTTTCATGGGCTGG
Strand - +
Off-target summary {0: 11, 1: 269, 2: 1293, 3: 1607, 4: 1336} {0: 350, 1: 579, 2: 976, 3: 1101, 4: 1218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!