ID: 1179776229_1179776237

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179776229 1179776237
Species Human (GRCh38) Human (GRCh38)
Location 21:43664944-43664966 21:43664968-43664990
Sequence CCCACCACGTGGGGATTATTACA TTCAAGGTGAGATTTGGGTGGGG
Strand - +
Off-target summary No data {0: 1232, 1: 9525, 2: 11059, 3: 8669, 4: 6495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!