ID: 1179794309_1179794323

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1179794309 1179794323
Species Human (GRCh38) Human (GRCh38)
Location 21:43773871-43773893 21:43773917-43773939
Sequence CCTCCATGCCCCCGAGGGGAAGG AAGAAAAAAGTCTAAAACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152} {0: 1, 1: 1, 2: 12, 3: 155, 4: 1504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!