ID: 1179808679_1179808686

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1179808679 1179808686
Species Human (GRCh38) Human (GRCh38)
Location 21:43856228-43856250 21:43856242-43856264
Sequence CCAGGGCCCTCATCACGCCCCCA ACGCCCCCACAGGGGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 236} {0: 1, 1: 0, 2: 1, 3: 16, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!