ID: 1179826412_1179826417

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1179826412 1179826417
Species Human (GRCh38) Human (GRCh38)
Location 21:43968590-43968612 21:43968611-43968633
Sequence CCTCCTGGGGCGTCTCTTTGAGC GCTCGGCAGTGGTGCCTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!