ID: 1179828729_1179828741

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1179828729 1179828741
Species Human (GRCh38) Human (GRCh38)
Location 21:43982877-43982899 21:43982922-43982944
Sequence CCTTGGCTCCCAGTGGGGGCCCC AGCACACCGGCACGAACGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 339} {0: 1, 1: 0, 2: 0, 3: 4, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!