ID: 1179841064_1179841068

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179841064 1179841068
Species Human (GRCh38) Human (GRCh38)
Location 21:44074163-44074185 21:44074192-44074214
Sequence CCCTTTCTCTCTCCTGTAGCTCT CACAGAACTGTTAGATGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 729} {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!