ID: 1179848651_1179848659

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1179848651 1179848659
Species Human (GRCh38) Human (GRCh38)
Location 21:44125633-44125655 21:44125655-44125677
Sequence CCCCATCGGGGCAGAAGCCCACT TGTCCCCTAAATGTTTCTGGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 5, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!