ID: 1179863044_1179863051

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1179863044 1179863051
Species Human (GRCh38) Human (GRCh38)
Location 21:44201506-44201528 21:44201545-44201567
Sequence CCCTGAGGTTCCTGGGCCTGCCA ATTTACTCTCGCTGTAAGGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 30, 4: 272} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!