ID: 1179863621_1179863625

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1179863621 1179863625
Species Human (GRCh38) Human (GRCh38)
Location 21:44204368-44204390 21:44204382-44204404
Sequence CCCTCCTCCTCATTCATCTGCCA CATCTGCCATCTGTGAAATGTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 11, 3: 47, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!