ID: 1179867662_1179867669

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1179867662 1179867669
Species Human (GRCh38) Human (GRCh38)
Location 21:44226629-44226651 21:44226665-44226687
Sequence CCCGCTGAAGCCGAGGAACAGCC ACCCAAAATGCCTCCAGACCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 101} {0: 2, 1: 0, 2: 6, 3: 52, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!