ID: 1179869678_1179869690 |
View in Genome Browser |
Spacer: 28 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1179869678 | 1179869690 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:44237400-44237422 | 21:44237451-44237473 |
| Sequence | CCATGTCAGTCTTTGGCTTCGAT | CATGGGGAGGAGCGGCTGGATGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 0, 2: 2, 3: 10, 4: 90} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||