ID: 1179874508_1179874526

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1179874508 1179874526
Species Human (GRCh38) Human (GRCh38)
Location 21:44261382-44261404 21:44261421-44261443
Sequence CCTGAACCCCCGCGGTGACACCC GATGAGGGGCAGGACAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85} {0: 1, 1: 0, 2: 3, 3: 32, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!