ID: 1179882629_1179882645

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1179882629 1179882645
Species Human (GRCh38) Human (GRCh38)
Location 21:44299958-44299980 21:44299991-44300013
Sequence CCTGCTCCGTCCAGGGTCCGTCC CGCCGGGGGCGGGCCCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 168} {0: 1, 1: 3, 2: 29, 3: 191, 4: 1248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!