ID: 1179905218_1179905226

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1179905218 1179905226
Species Human (GRCh38) Human (GRCh38)
Location 21:44419082-44419104 21:44419107-44419129
Sequence CCTTCCGCCCTGCTAGGTGTCAG GGGCCTAATGGCCCAGCAGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!