ID: 1179907974_1179907978

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1179907974 1179907978
Species Human (GRCh38) Human (GRCh38)
Location 21:44434015-44434037 21:44434032-44434054
Sequence CCGGTGCTAGAGGTGGTCAGCTG CAGCTGTCCTGGGGCAGCCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 62, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!