ID: 1179912783_1179912791

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1179912783 1179912791
Species Human (GRCh38) Human (GRCh38)
Location 21:44459245-44459267 21:44459277-44459299
Sequence CCAGGCAGGGCCAGCATGTGGCG GCTCCACTGTTTGGAGGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 215} {0: 1, 1: 1, 2: 0, 3: 18, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!