ID: 1179937271_1179937283

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1179937271 1179937283
Species Human (GRCh38) Human (GRCh38)
Location 21:44613568-44613590 21:44613601-44613623
Sequence CCCTCCCTGTGTGCCGCCCGCCC CTCGCTTAGCAGCAATGCGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 34, 4: 423} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!