ID: 1179963847_1179963850

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1179963847 1179963850
Species Human (GRCh38) Human (GRCh38)
Location 21:44788741-44788763 21:44788757-44788779
Sequence CCCAGGCTGGAGTCCAGTGGGCA GTGGGCAACCAGAGTGAGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!