ID: 1179976839_1179976850

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1179976839 1179976850
Species Human (GRCh38) Human (GRCh38)
Location 21:44873304-44873326 21:44873345-44873367
Sequence CCCAGCCGCGACGGCAGCTCCCG GACCCTCGAGGAGCCTCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95} {0: 1, 1: 0, 2: 2, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!