ID: 1179976846_1179976850

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1179976846 1179976850
Species Human (GRCh38) Human (GRCh38)
Location 21:44873324-44873346 21:44873345-44873367
Sequence CCGCGGCCGCCAAACGGGCGTGA GACCCTCGAGGAGCCTCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56} {0: 1, 1: 0, 2: 2, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!