ID: 1179980279_1179980288

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1179980279 1179980288
Species Human (GRCh38) Human (GRCh38)
Location 21:44891933-44891955 21:44891981-44892003
Sequence CCCGGATGACAAACGACTGCTCC TCACCTGGAAGGTGATCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87} {0: 1, 1: 0, 2: 0, 3: 27, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!