ID: 1179983767_1179983785

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1179983767 1179983785
Species Human (GRCh38) Human (GRCh38)
Location 21:44910209-44910231 21:44910254-44910276
Sequence CCACTGGCTTCAGGGGCAGGAAA CAGGTGGGGAGGGGTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 300} {0: 1, 1: 0, 2: 9, 3: 106, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!