ID: 1179992995_1179993004

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1179992995 1179993004
Species Human (GRCh38) Human (GRCh38)
Location 21:44958327-44958349 21:44958371-44958393
Sequence CCGGCCCTCCTCCAAGCTGGCAT CTCCTGTGCTTCCGCAGCACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 25, 4: 300} {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!