ID: 1179995055_1179995066

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1179995055 1179995066
Species Human (GRCh38) Human (GRCh38)
Location 21:44970429-44970451 21:44970481-44970503
Sequence CCGAGCACCAACAGGTAACCCAG GCTGTTTCTCTAGGGAGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 18, 3: 80, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!