ID: 1180014564_1180014570

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1180014564 1180014570
Species Human (GRCh38) Human (GRCh38)
Location 21:45074068-45074090 21:45074083-45074105
Sequence CCGCTGCAGGGAGGAGCGCGGGG GCGCGGGGGCCCGGGAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 37, 4: 279} {0: 1, 1: 0, 2: 2, 3: 52, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!