ID: 1180014824_1180014839

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1180014824 1180014839
Species Human (GRCh38) Human (GRCh38)
Location 21:45075006-45075028 21:45075045-45075067
Sequence CCCGGAGGAAGCTGCGCCCGGGC CCGAGGGCGCCGAGTCCGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 208} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!