ID: 1180020841_1180020848

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1180020841 1180020848
Species Human (GRCh38) Human (GRCh38)
Location 21:45125586-45125608 21:45125616-45125638
Sequence CCCGCCTGCTGGGACTCATTGGG AGATCTTCCCACACAAGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!