ID: 1180032915_1180032930

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1180032915 1180032930
Species Human (GRCh38) Human (GRCh38)
Location 21:45224490-45224512 21:45224531-45224553
Sequence CCTGGGTGGGGCAGCTGTGGGGA CCCTGGGCGGGGCGGCTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 513} {0: 1, 1: 1, 2: 2, 3: 60, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!