ID: 1180042579_1180042587

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1180042579 1180042587
Species Human (GRCh38) Human (GRCh38)
Location 21:45287824-45287846 21:45287858-45287880
Sequence CCAGGACACTGCCCCCAGCAGCA CTGAGTGTCGCCATGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 405} {0: 1, 1: 0, 2: 0, 3: 19, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!