ID: 1180049314_1180049333

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1180049314 1180049333
Species Human (GRCh38) Human (GRCh38)
Location 21:45324132-45324154 21:45324171-45324193
Sequence CCAACCCTCAGCCTCCCCACCCC GCTGAGCCTGCTGTGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 28, 3: 318, 4: 2254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!