ID: 1180061953_1180061959

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1180061953 1180061959
Species Human (GRCh38) Human (GRCh38)
Location 21:45390212-45390234 21:45390244-45390266
Sequence CCTGCTGAGCACTCACCTCACCG CAGGTAACGAACTCGGCCGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!