ID: 1180084996_1180085015

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1180084996 1180085015
Species Human (GRCh38) Human (GRCh38)
Location 21:45504510-45504532 21:45504555-45504577
Sequence CCGGCCCCCCAGGCCCCCCAGGC CAGTAAGTCCCAGCCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 10, 3: 169, 4: 1352} {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!