ID: 1180085004_1180085015

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1180085004 1180085015
Species Human (GRCh38) Human (GRCh38)
Location 21:45504524-45504546 21:45504555-45504577
Sequence CCCCCAGGCCCACGTGGCTACCC CAGTAAGTCCCAGCCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 267} {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!