ID: 1180085243_1180085247

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1180085243 1180085247
Species Human (GRCh38) Human (GRCh38)
Location 21:45505301-45505323 21:45505321-45505343
Sequence CCGGGCAGAGGCCGCCTCGTGTG GTGGCTTCGTGTTCCCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163} {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!