ID: 1180122990_1180122998

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1180122990 1180122998
Species Human (GRCh38) Human (GRCh38)
Location 21:45766310-45766332 21:45766336-45766358
Sequence CCCTAGTATGACTGCTTTTGGAG GGGCCCTTGGGAGGTGATTAAGG
Strand - +
Off-target summary No data {0: 2, 1: 26, 2: 102, 3: 213, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!