ID: 1180159341_1180159359

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180159341 1180159359
Species Human (GRCh38) Human (GRCh38)
Location 21:45992156-45992178 21:45992196-45992218
Sequence CCCCACAGGGCCAGCCGGGAGAG GAAAGGAGAGGCGGGCGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 257} {0: 1, 1: 0, 2: 0, 3: 20, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!